pLentiCRISPRv2-sgFXN-1
(Plasmid
#246017)
-
PurposeAll-in-one CRISPRko plasmid containing Cas9 and guide RNA targeting FXN
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246017 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLentiCRISPRv2 (Addgene #52961)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFrataxin
-
Alt nameFXN
-
gRNA/shRNA sequencecggcgcggatacttactgcg
-
SpeciesH. sapiens (human)
-
Entrez GeneFXN (a.k.a. CyaY, FA, FARR, FRDA, X25)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPRv2-sgFXN-1 was a gift from Vamsi Mootha (Addgene plasmid # 246017 ; http://n2t.net/addgene:246017 ; RRID:Addgene_246017) -
For your References section:
Hypoxia Rescues Frataxin Loss by Restoring Iron Sulfur Cluster Biogenesis. Ast T, Meisel JD, Patra S, Wang H, Grange RMH, Kim SH, Calvo SE, Orefice LL, Nagashima F, Ichinose F, Zapol WM, Ruvkun G, Barondeau DP, Mootha VK. Cell. 2019 May 30;177(6):1507-1521.e16. doi: 10.1016/j.cell.2019.03.045. Epub 2019 Apr 25. 10.1016/j.cell.2019.03.045 PubMed 31031004
Map uploaded by the depositor.
