pHSV-ELGA
(Plasmid
#246796)
-
PurposeBioluminescent endolysosomal Ca2+ indicator
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246796 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHSV1
-
Backbone manufacturerOur lab
- Backbone size w/o insert (bp) 4791
- Total vector size (bp) 6900
-
Vector typeMammalian Expression ; Herpes viral vector
-
Selectable markersNone
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameELGA (Endo-lysosome GFP-Aequorin)
-
Alt nameVAMP7-GA
-
Alt nameVAMP7-EGFP-mutAEQ
-
Alt nameVAMP7 endo-lysosome targeting sequence-EGFP-mutAequorin (D119A)
-
SpeciesH. sapiens (human); Aequora victoria (jellyfish)
-
Insert Size (bp)2097
-
MutationD119A in aequorin gene
- Promoter IE4/5 promoter (from HSV)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCAGGAGGAACGTCCTCGTCGATAA
- 3′ sequencing primer GTGGAGCTGTCCCCTAAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHSV-ELGA was a gift from Teresa Alonso (Addgene plasmid # 246796 ; http://n2t.net/addgene:246796 ; RRID:Addgene_246796) -
For your References section:
Direct measurements of luminal Ca2+ with endo-lysosomal GFP-aequorin reveal functional IP3 receptors. Calvo B, Torres-Vidal P, Delrio-Lorenzo A, Rodriguez C, Aulestia FJ, Rojo-Ruiz J, Callejo B, McVeigh BM, Keller M, Grimm C, Oorschot V, Moiseenkova-Bell V, Yule DI, Garcia-Sancho J, Patel S, Alonso MT. J Cell Biol. 2025 Dec 1;224(12):e202410094. doi: 10.1083/jcb.202410094. Epub 2025 Nov 7. 10.1083/jcb.202410094 PubMed 41201441