Skip to main content
Addgene
Open Menu

pHSV-ELGA
(Plasmid #246796)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 246796 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pHSV1
  • Backbone manufacturer
    Our lab
  • Backbone size w/o insert (bp) 4791
  • Total vector size (bp) 6900
  • Vector type
    Mammalian Expression ; Herpes viral vector
  • Selectable markers
    None

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ELGA (Endo-lysosome GFP-Aequorin)
  • Alt name
    VAMP7-GA
  • Alt name
    VAMP7-EGFP-mutAEQ
  • Alt name
    VAMP7 endo-lysosome targeting sequence-EGFP-mutAequorin (D119A)
  • Species
    H. sapiens (human); Aequora victoria (jellyfish)
  • Insert Size (bp)
    2097
  • Mutation
    D119A in aequorin gene
  • Promoter IE4/5 promoter (from HSV)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GCAGGAGGAACGTCCTCGTCGATAA
  • 3′ sequencing primer GTGGAGCTGTCCCCTAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHSV-ELGA was a gift from Teresa Alonso (Addgene plasmid # 246796 ; http://n2t.net/addgene:246796 ; RRID:Addgene_246796)

  • For your References section:

    Direct measurements of luminal Ca2+ with endo-lysosomal GFP-aequorin reveal functional IP3 receptors. Calvo B, Torres-Vidal P, Delrio-Lorenzo A, Rodriguez C, Aulestia FJ, Rojo-Ruiz J, Callejo B, McVeigh BM, Keller M, Grimm C, Oorschot V, Moiseenkova-Bell V, Yule DI, Garcia-Sancho J, Patel S, Alonso MT. J Cell Biol. 2025 Dec 1;224(12):e202410094. doi: 10.1083/jcb.202410094. Epub 2025 Nov 7. 10.1083/jcb.202410094 PubMed 41201441
Related items:
Commonly requested with: