Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pCDNA5FRT/TO_HA-mAID-nanobody
(Plasmid #117713)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 117713 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCDNA5 FRT/TO
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 4850
  • Total vector size (bp) 5561
  • Modifications to backbone
    Hygromycin resistance exchanged to Neomycin
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mAID-nanobody
  • Species
    Synthetic
  • Mutation
    codon optimized mAID for murine expression
  • Promoter CMV
  • Tag / Fusion Protein
    • triple HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    codon-optimized A. thaliana AID (IAA17) was obtained from Francis Stewart (TU Dresden, BIOTEC, Tatzberg 47-49, 01307 Dresden, Germany.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

codon-optimized A. thaliana AID (IAA17) is described in:

Baker, O. et al. RAC-tagging: Recombineering And Cas9-assisted targeting for protein tagging and conditional analyses. Sci Rep 6, 25529 (2016).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDNA5FRT/TO_HA-mAID-nanobody was a gift from Joerg Mansfeld (Addgene plasmid # 117713 ; http://n2t.net/addgene:117713 ; RRID:Addgene_117713)
  • For your References section:

    Conditional control of fluorescent protein degradation by an auxin-dependent nanobody. Daniel K, Icha J, Horenburg C, Muller D, Norden C, Mansfeld J. Nat Commun. 2018 Aug 17;9(1):3297. doi: 10.1038/s41467-018-05855-5. 10.1038/s41467-018-05855-5 [pii] PubMed 30120238