Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCAGGs-NLS-TIR1_P2A_NES-TIR1
(Plasmid #117699)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117699 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    custom
  • Backbone manufacturer
    Francis Stewart
  • Backbone size w/o insert (bp) 6399
  • Total vector size (bp) 10062
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    TRANSPORT INHIBITOR RESPONSE 1
  • Alt name
    TIR1
  • Species
    Oryza sativa
  • Insert Size (bp)
    1794
  • Mutation
    codon optimized for murine expression
  • Promoter chicken beta-actin promoter
  • Tags / Fusion Proteins
    • HA tag (C terminal on insert)
    • NLS (N terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    TRANSPORT INHIBITOR RESPONSE 1
  • Alt name
    TIR1
  • Species
    Oryza sativa
  • Insert Size (bp)
    1794
  • Mutation
    codon optimized for murine expression
  • Promoter None, 2A peptide from porcine teschovirus-1 polyprotein
  • Tag / Fusion Protein
    • Myc-NES (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrG1 (not destroyed)
  • 3′ cloning site BsrG1 (not destroyed)
  • 5′ sequencing primer GGCTACCCATACGATGTTCC
  • 3′ sequencing primer ATGGTGGAAAATAACATATAGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The codon optimized NLS-TIR1 is described in:

Baker, O. et al. RAC-tagging: Recombineering And Cas9-assisted targeting for protein tagging and conditional analyses. Sci Rep 6, 25529 (2016).

Some ambiguous bases and differences are present between the depositor sequence and Addgene's NGS sequence, but they are not expected to impact plasmid functionality.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGs-NLS-TIR1_P2A_NES-TIR1 was a gift from Joerg Mansfeld (Addgene plasmid # 117699 ; http://n2t.net/addgene:117699 ; RRID:Addgene_117699)
  • For your References section:

    Conditional control of fluorescent protein degradation by an auxin-dependent nanobody. Daniel K, Icha J, Horenburg C, Muller D, Norden C, Mansfeld J. Nat Commun. 2018 Aug 17;9(1):3297. doi: 10.1038/s41467-018-05855-5. 10.1038/s41467-018-05855-5 [pii] PubMed 30120238