pIRES_IBB-mCherry-IRES-HA-mAID-nanobody
(Plasmid #117720)

• Purpose: Expression of nuclear transfection marker IBB-mCherry and HA-tagged mAID-nanobody from one mRNA
• Depositing Lab: Joerg Mansfeld
• Publication: Daniel et al Nat Commun. 2018 Aug 17;9(1):3297. doi: 10.1038/s41467-018-05855-5.

Backbone

• Vector backbone: pIRESpuro
• Backbone manufacturer: Thermo Fisher Scientific
• Backbone size w/o insert (bp): 2539
• Total vector size (bp): 6118
• Modifications to backbone: Puromycin resistance gene was exchanged with mAID-nanobody
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: mAID-nanobody
• Species: Synthetic
• Insert Size (bp): 714
• Mutation: codon optimized mAID for murine expression
• Promoter: None, IRES-driven
• Tag / Fusion Protein:
  • triple HA (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: XmaI (not destroyed)
• 5′ sequencing primer: CTTTACATGTGTTTAGTCGAGG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGGC

Gene/Insert 2

• Gene/Insert name: IBB-mCherry
• Species: Discosoma sp
• Insert Size (bp): 903
• Promoter: CMV
• Tag / Fusion Protein:
  • importin-beta bining domain (IBB) (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: codon-optimized A. thaliana AID (IAA17) was obtained from Francis Stewart (TU Dresden, BIOTEC, Tatzberg 47-49, 01307 Dresden, Germany

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

codon-optimized A. thaliana AID (IAA17) is described in:

Baker, O. et al. RAC-tagging: Recombineering And Cas9-assisted targeting for protein tagging and conditional analyses. Sci Rep 6, 25529 (2016).