Skip to main content
Addgene
Open Menu

pET-TP1107(Q15TAG)
(Plasmid #247462)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 247462 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pET His6 TEV LIC cloning vector (1B)
  • Backbone manufacturer
    Scott Gradia (Plasmid #29653)
  • Backbone size w/o insert (bp) 5343
  • Total vector size (bp) 5694
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Use with companion plasmid expressing orthogonal tRNA and synthetase for unnatural amino acid incorporation e.g. pEVOL-pAzF (Plasmid #31186)
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    TP1107 Q15TAG
  • Species
    Alpaca (Vicugna pacos)
  • Insert Size (bp)
    408
  • Mutation
    Original Q15 codon (CAA) was modified to amber stop codon (UAG) to facilitate synthetic amino acid incorporation in recognition of UAG codon.
  • Promoter T7
  • Tags / Fusion Proteins
    • His6 (C terminal on insert)
    • TEV protease cleavage site (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Sequence modified from Pleiner T, Bates M, Görlich D. A toolbox of anti-mouse and anti-rabbit IgG secondary nanobodies. J Cell Biol. 2018 Mar 5;217(3):1143-1154.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-TP1107(Q15TAG) was a gift from Angus Johnston (Addgene plasmid # 247462 ; http://n2t.net/addgene:247462 ; RRID:Addgene_247462)

  • For your References section:

    A versatile antibody capture system drives specific in vivo delivery of mRNA-loaded lipid nanoparticles. Chen MZ, Yuen D, McLeod VM, Yong KW, Smyth CH, Herling BR, Payne TJ, Fabb SA, Belousoff MJ, Algarni A, Sexton PM, Porter CJH, Pouton CW, Johnston APR. Nat Nanotechnol. 2025 Sep;20(9):1273-1284. doi: 10.1038/s41565-025-01954-9. Epub 2025 Aug 4. 10.1038/s41565-025-01954-9 PubMed 40759744
Related items:
Commonly requested with: