Skip to main content
Addgene
Open Menu

pcDNA5/FRT-DREADD-Gs
(Plasmid #247957)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 247957 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pcDNA5/FRT
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DREADD-Gs
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Gene Synthesis
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer tagaaggcacagtcgagg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5/FRT-DREADD-Gs was a gift from Giovanni Marsicano (Addgene plasmid # 247957 ; http://n2t.net/addgene:247957 ; RRID:Addgene_247957)

  • For your References section:

    Potentiation of mitochondrial function by mitoDREADD-G(s) reverses pharmacological and neurodegenerative cognitive impairment in mice. Pagano Zottola AC, Martin-Jimenez R, Lavanco G, Hamel-Cote G, Ramon-Duaso C, Rodrigues RS, Mariani Y, Khan M, Drago F, Jean S, Rio IB, Jimenez-Blasco D, Egana-Huguet J, Eraso-Pichot A, Beriain S, Cannich A, Vidal-Palencia L, Infantino R, Julio-Kalajzic F, Gisquet D, Goncalves A, Al-Younis I, Baussan Y, Duvezin-Caubet S, Devin A, Soria-Gomez E, Puente N, Bolanos JP, Grandes P, Pouvreau S, Busquets-Garcia A, Marsicano G, Bellocchio L, Hebert-Chatelain E. Nat Neurosci. 2025 Sep;28(9):1844-1857. doi: 10.1038/s41593-025-02032-y. Epub 2025 Aug 11. 10.1038/s41593-025-02032-y PubMed 40790270
Related items: