pLVX-TetOne-Off-PHB2-mStayGold-blast
(Plasmid #249603)

• Purpose: For all-in-one Tet-Off inducible expression in mammalian cells
• Depositing Lab: Richard Youle
• Publication: Prohibitin inhibits DELE1-mediated integrated stress response by blocking Oma1 activation (unpublished)

Backbone

• Vector backbone: pLVX-TetOne
• Backbone manufacturer: Takara Bio
• Backbone size w/o insert (bp): 9026
• Total vector size (bp): 10668
• Modifications to backbone: Replaced the rtTA in pLVX-TetOne-puro with tTA from pLVX-Tet-Off-advanced at XbaI/MluI sites. tTA is further codon-optimized and synthesized as a string DNA fragment for Gibson cloning. The puromycin is then replaced by blasticidin to make pLVX-TetOne-Off-bla vector
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Prohibitin 2
• Alt name: PHB2
• Species: M. musculus (mouse)
• Insert Size (bp): 897
• Mutation: codon optimized
• Entrez Gene: Phb2 (a.k.a. BAP, Bap37, Bcap37, REA)
• Tag / Fusion Protein:
  • mStayGold (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TGAGTAAACTTCAATTCCACAACA
• 3′ sequencing primer: GTGAAAAATGTCACTCTCTTACCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry