Skip to main content

pLVX-TetOne-Off-PHB2-mStayGold-blast
(Plasmid #249603)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 249603 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLVX-TetOne
  • Backbone manufacturer
    Takara Bio
  • Backbone size w/o insert (bp) 9026
  • Total vector size (bp) 10668
  • Modifications to backbone
    Replaced the rtTA in pLVX-TetOne-puro with tTA from pLVX-Tet-Off-advanced at XbaI/MluI sites. tTA is further codon-optimized and synthesized as a string DNA fragment for Gibson cloning. The puromycin is then replaced by blasticidin to make pLVX-TetOne-Off-bla vector
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Prohibitin 2
  • Alt name
    PHB2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    897
  • Mutation
    codon optimized
  • Entrez Gene
    Phb2 (a.k.a. BAP, Bap37, Bcap37, REA)
  • Tag / Fusion Protein
    • mStayGold (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGAGTAAACTTCAATTCCACAACA
  • 3′ sequencing primer GTGAAAAATGTCACTCTCTTACCC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVX-TetOne-Off-PHB2-mStayGold-blast was a gift from Richard Youle (Addgene plasmid # 249603 ; http://n2t.net/addgene:249603 ; RRID:Addgene_249603)