Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAL119-hCTLA4-Ig
(Plasmid #25100)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 25100 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ytotoxic T-murine Lymphocyte Antigen 4
  • Alt name
    mCTLA4-IGHG1
  • Alt name
    CTLA4
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2095
  • Entrez Gene
    Ctla4 (a.k.a. Cd152, Ctla-4, Ly-56)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site BamHI (destroyed during cloning)
  • 5′ sequencing primer For tk 656- 5' AGCGGTTTGACTCACGGGGATTTC 3'
  • 3′ sequencing primer rev tk 2404 -5' CCTGGTGCGGGTCTCATCGTA 3'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAL119-hCTLA4-Ig was a gift from Maria Castro (Addgene plasmid # 25100 ; http://n2t.net/addgene:25100 ; RRID:Addgene_25100)
  • For your References section:

    Active suppression of allogeneic proliferative responses by dendritic cells after induction of long-term allograft survival by CTLA4Ig. Guillot C, Menoret S, Guillonneau C, Braudeau C, Castro MG, Lowenstein P, Anegon I. Blood. 2003 Apr 15. 101(8):3325-33. 10.1182/blood-2002-07-2076 PubMed 12515725