Lenti-A3An-LRG2.1T
(Plasmid
#253343)
-
PurposeExpresses the N-terminal fragment of a rapamycin-inducible split A3A cytosine base editor together with an sgRNA expression cassette for in vivo base editing
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253343 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLentiV
-
Vector typeLentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameA3An
-
SpeciesH. sapiens (human)
- Promoter EFS
-
Tag
/ Fusion Protein
- myc-A3An-FRB
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AACCGGTGCCTAGAGAAGGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-A3An-LRG2.1T was a gift from Junwei Shi (Addgene plasmid # 253343 ; http://n2t.net/addgene:253343 ; RRID:Addgene_253343) -
For your References section:
Inducible, split base editors for in vivo cancer functional genomics. Ren D, Wang S, Yamada K, Liu Y, Hapke R, Alpsoy A, Ho Y, Zhang C, Lan Y, Zhang S, Milazzo JP, Lohia R, Berríos KN, Li Y, Weber EW, Li Q, Vakoc CR, Minn AJ, Kohli RM, Shi J. Nat Biotechnol. 2026 Apr 15. doi: 10.1038/s41587-026-03077-5 10.1038/s41587-026-03077-5
Map uploaded by the depositor.
