YCPlac33-sGFP-VRG4
(Plasmid
#25447)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 25447 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneYCPlac33
- Backbone size w/o insert (bp) 5500
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSynthetic Green Fluorescent Protein - VRG4
-
Alt namesGFP-VRG4
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2985
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer gcgggcagtgagcgcaacgcaattaa (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
YCPlac33-sGFP-VRG4 was a gift from Benjamin Glick (Addgene plasmid # 25447 ; http://n2t.net/addgene:25447 ; RRID:Addgene_25447) -
For your References section:
Golgi maturation visualized in living yeast. Losev E, Reinke CA, Jellen J, Strongin DE, Bevis BJ, Glick BS. Nature. 2006 Jun 22. 441(7096):1002-6. 10.1038/nature04717 PubMed 16699524