Skip to main content

pSLIK-Neo
(Plasmid #25735)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 25735 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSLIK
  • Backbone manufacturer
    Iain Fraser
  • Backbone size (bp) 13286
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DB3.1
  • Growth instructions
    DB3.1 (ccdB survival)
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    None

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ cloning site attR1 (not destroyed)
  • 3′ cloning site attR2 (not destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer hUBCpro-R (CTAAGGCCGAGTCTTATGAGCAG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    rtTA3- Atze Das, University of Amsterdam; NeoR- Clontech plasmid; pDS cassette- Invitrogen
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Parent lentivector, co-expression of Neomycin selection gene

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLIK-Neo was a gift from Iain Fraser (Addgene plasmid # 25735 ; http://n2t.net/addgene:25735 ; RRID:Addgene_25735)
  • For your References section:

    A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Shin KJ, Wall EA, Zavzavadjian JR, Santat LA, Liu J, Hwang JI, Rebres R, Roach T, Seaman W, Simon MI, Fraser ID. Proc Natl Acad Sci U S A. 2006 Sep 12. 103(37):13759-64. 10.1073/pnas.0606179103 PubMed 16945906