Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pSLIK-Venus-TmiR-G13-G12
(Plasmid #25742)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 25742 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSLIK
  • Backbone manufacturer
    Iain Fraser
  • Backbone size w/o insert (bp) 12752
  • Vector type
    Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    G alpha 13 and 12 miR-shRNA
  • Species
    M. musculus (mouse)
  • Tag / Fusion Protein
    • Venus (C terminal on backbone)

Cloning Information

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    rtTA- Atze Das, University of Amsterdam; TRE promoter- David Anderson, Caltech; miR30- Greg Hannon, CSHL Venus- Tobias Meyer, Stanford

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pSLIK-Venus with G alpha 12 and 13 miR-shRNA

G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT

G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT

There are 3 minor changes between depositor's sequence and Addgene's sequence - An extra T between the TRE promoter and first shRNA; a 17nt stretch between the shRNAs is different but will not affect function; and a single nt change mutates an EcoRI site just beyond the 2nd shRNA but will again not affect function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLIK-Venus-TmiR-G13-G12 was a gift from Iain Fraser (Addgene plasmid # 25742 ; http://n2t.net/addgene:25742 ; RRID:Addgene_25742)
  • For your References section:

    A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Shin KJ, Wall EA, Zavzavadjian JR, Santat LA, Liu J, Hwang JI, Rebres R, Roach T, Seaman W, Simon MI, Fraser ID. Proc Natl Acad Sci U S A. 2006 Sep 12. 103(37):13759-64. 10.1073/pnas.0606179103 PubMed 16945906