Skip to main content

pEN_TGmiR_Gb2-K
(Plasmid #25766)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 25766 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pENTR1A-Gent
  • Backbone manufacturer
    ATCC 10326362
  • Backbone size w/o insert (bp) 4990
  • Vector type
    Entry vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Growth instructions
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Gb2 miR-shRNA
  • Alt name
    G beta 2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    22
  • Entrez Gene
    Gnb2 (a.k.a. Gnb-2)
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site attL1 (not destroyed)
  • 3′ cloning site attL2 (not destroyed)
  • 5′ sequencing primer pCEP-fwd
  • 3′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    TRE promoter- David Anderson, Caltech; miR30- Greg Hannon, CSHL

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Entry vector with TRE-driven G beta 2 miR-shRNA (TGCTCATGTATTCCCACGACAA) and co-expressed GFP

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEN_TGmiR_Gb2-K was a gift from Iain Fraser (Addgene plasmid # 25766 ; http://n2t.net/addgene:25766 ; RRID:Addgene_25766)
  • For your References section:

    A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Shin KJ, Wall EA, Zavzavadjian JR, Santat LA, Liu J, Hwang JI, Rebres R, Roach T, Seaman W, Simon MI, Fraser ID. Proc Natl Acad Sci U S A. 2006 Sep 12. 103(37):13759-64. 10.1073/pnas.0606179103 PubMed 16945906