Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #25766)


Item Catalog # Description Quantity Price (USD)
Plasmid 25766 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    ATCC 10326362
  • Backbone size w/o insert (bp) 4990
  • Vector type
    Entry vector

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
  • Copy number


  • Gene/Insert name
    Gb2 miR-shRNA
  • Alt name
    G beta 2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Entrez Gene
    Gnb2 (a.k.a. Gnb-2)
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site attL1 (not destroyed)
  • 3′ cloning site attL2 (not destroyed)
  • 5′ sequencing primer pCEP-fwd
  • 3′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    TRE promoter- David Anderson, Caltech; miR30- Greg Hannon, CSHL

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Entry vector with TRE-driven G beta 2 miR-shRNA (TGCTCATGTATTCCCACGACAA) and co-expressed GFP

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEN_TGmiR_Gb2-K was a gift from Iain Fraser (Addgene plasmid # 25766 ; ; RRID:Addgene_25766)
  • For your References section:

    A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Shin KJ, Wall EA, Zavzavadjian JR, Santat LA, Liu J, Hwang JI, Rebres R, Roach T, Seaman W, Simon MI, Fraser ID. Proc Natl Acad Sci U S A. 2006 Sep 12. 103(37):13759-64. 10.1073/pnas.0606179103 PubMed 16945906