Skip to main content

mCol.4F2A targeting construct
(Plasmid #25794)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 25794 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    mCol.loxneo
  • Backbone size w/o insert (bp) 10600
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Oct4-P2A-Sox2-T2A-Klf4-E2A-cMyc
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    5000

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer tagagaaaagtgaaagtcgagtttac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCol.4F2A targeting construct was a gift from Rudolf Jaenisch (Addgene plasmid # 25794 ; http://n2t.net/addgene:25794 ; RRID:Addgene_25794)
  • For your References section:

    Single-gene transgenic mouse strains for reprogramming adult somatic cells. Carey BW, Markoulaki S, Beard C, Hanna J, Jaenisch R. Nat Methods. 2010 Jan . 7(1):56-9. 10.1038/nmeth.1410 PubMed 20010831