Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pWPI_SPbFGF
(Plasmid #25812)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 25812 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pWPI
  • Backbone size w/o insert (bp) 11101
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pWPI_SPbFGF
  • Alt name
    FGF2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    620
  • Mutation
    Ig signal peptide in N-terminal of human FGF2
  • Entrez Gene
    FGF2 (a.k.a. BFGF, FGF-2, FGFB, HBGF-2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PmeI (destroyed during cloning)
  • 3′ cloning site PmeI (destroyed during cloning)
  • 5′ sequencing primer attctcaagcctcagacagt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWPI_SPbFGF was a gift from Jozsef Kiss & Patrick Salmon (Addgene plasmid # 25812 ; http://n2t.net/addgene:25812 ; RRID:Addgene_25812)
  • For your References section:

    Expression of FGF-2 in neural progenitor cells enhances their potential for cellular brain repair in the rodent cortex. Dayer AG, Jenny B, Sauvain MO, Potter G, Salmon P, Zgraggen E, Kanemitsu M, Gascon E, Sizonenko S, Trono D, Kiss JZ. Brain. 2007 Nov . 130(Pt 11):2962-76. 10.1093/brain/awm200 PubMed 17728358