Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pFUGW-H1 empty vector
(Plasmid #25870)


Item Catalog # Description Quantity Price (USD)
Plasmid 25870 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Ivanova, NB
  • Backbone size (bp) 10130
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Zeo marker is outside the LTRs and will not be packaged into virus.

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Promoter H1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site see below (not destroyed)
  • 3′ cloning site see below (not destroyed)
  • 5′ sequencing primer H1 (5'-tcgctatgtgttctgggaaa-3')
  • 3′ sequencing primer cagtgcaggggaaagaatagtagac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Empty Vector pFUGW-H1.

The H1 promoter was cloned into the PacI site of FUGW (Addgene Plasmid# 14883). Please see cloning protocol for recommended shRNA subcloning procedure.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUGW-H1 empty vector was a gift from Sally Temple (Addgene plasmid # 25870 ; ; RRID:Addgene_25870)
  • For your References section:

    shRNA knockdown of Bmi-1 reveals a critical role for p21-Rb pathway in NSC self-renewal during development. Fasano CA, Dimos JT, Ivanova NB, Lowry N, Lemischka IR, Temple S. Cell Stem Cell. 2007 Jun 7. 1(1):87-99. 10.1016/j.stem.2007.04.001 PubMed 18371338