-
Purpose(Empty Backbone) 3rd generation lentiviral vector
-
Depositing Lab
-
Depositing OrganizationRegenerative Research Foundation
Located in the United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 25870 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneFUGW-H1
-
Backbone manufacturerIvanova, NB
- Backbone size (bp) 10130
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersZeo marker is outside the LTRs and will not be packaged into virus.
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNone
- Promoter H1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site see below (not destroyed)
- 3′ cloning site see below (not destroyed)
- 5′ sequencing primer H1 (5'-tcgctatgtgttctgggaaa-3')
- 3′ sequencing primer cagtgcaggggaaagaatagtagac
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Empty Vector pFUGW-H1.
The H1 promoter was cloned into the PacI site of FUGW (Addgene Plasmid# 14883). Please see cloning protocol for recommended shRNA subcloning procedure.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUGW-H1 empty vector was a gift from Sally Temple (Addgene plasmid # 25870 ; http://n2t.net/addgene:25870 ; RRID:Addgene_25870) -
For your References section:
shRNA knockdown of Bmi-1 reveals a critical role for p21-Rb pathway in NSC self-renewal during development. Fasano CA, Dimos JT, Ivanova NB, Lowry N, Lemischka IR, Temple S. Cell Stem Cell. 2007 Jun 7. 1(1):87-99. 10.1016/j.stem.2007.04.001 PubMed 18371338