Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

LV-CFP
(Plasmid #25998)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 25998 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO.1
  • Backbone size w/o insert (bp) 6406
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    H2B-CFP
  • Species
    H. sapiens (human); A. victoria
  • Insert Size (bp)
    1113
  • Entrez Gene
    H2BC21 (a.k.a. GL105, H2B, H2B-GL105, H2B.1, H2BE, H2BFQ, H2BGL105, H2BQ, HIST2H2BE)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site NsiI (not destroyed)
  • 5′ sequencing primer CCTTCACCGAGGGCCTATTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LV-CFP was a gift from Elaine Fuchs (Addgene plasmid # 25998 ; http://n2t.net/addgene:25998 ; RRID:Addgene_25998)
  • For your References section:

    Rapid functional dissection of genetic networks via tissue-specific transduction and RNAi in mouse embryos. Beronja S, Livshits G, Williams S, Fuchs E. Nat Med. 2010 Jul . 16(7):821-7. 10.1038/nm.2167 PubMed 20526348