Skip to main content

pFB-Flag-MyoD(QQQ)-E12
(Plasmid #26003)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 26003 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFastBac1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4775
  • Vector type
    Baculovirus transfer vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MyoD(QQQ)-E12 Heterodimer Fusion
  • Alt name
    MyoD forced heterodimer
  • Alt name
    Acetylation mimic mutant
  • Alt name
    MyoD
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3013
  • Mutation
    Changed Lysine 99 to Glutamine; Lysine 102 to Glutamine; and Lysine 104 to Glutamine in MyoD. Additional A218T in E2A/E12
  • GenBank ID
    BC103613
  • Entrez Gene
    Myod1 (a.k.a. MYF3, MyoD, Myod-1, bHLHc1)
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TATTCCGGATTATTCATACC
  • 3′ sequencing primer CTGATTATGATCCTCTAGTAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFB-Flag-MyoD(QQQ)-E12 was a gift from Jeffrey Dilworth (Addgene plasmid # 26003 ; http://n2t.net/addgene:26003 ; RRID:Addgene_26003)
  • For your References section:

    In vitro transcription system delineates the distinct roles of the coactivators pCAF and p300 during MyoD/E47-dependent transactivation. Dilworth FJ, Seaver KJ, Fishburn AL, Htet SL, Tapscott SJ. Proc Natl Acad Sci U S A. 2004 Aug 10. 101(32):11593-8. 10.1073/pnas.0404192101 PubMed 15289617