Skip to main content

LZRS-Flag_EZH2_ER
(Plasmid #26111)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 26111 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LZRS
  • Backbone size w/o insert (bp) 11100
  • Vector type
    Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl2
  • Growth instructions
    STBL2
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    EZH2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2253
  • Entrez Gene
    EZH2 (a.k.a. ENX-1, ENX1, EZH2b, KMT6, KMT6A, WVS, WVS2)
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • ER (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ cloning site attR (destroyed during cloning)
  • 3′ cloning site attR (destroyed during cloning)
  • 5′ sequencing primer TGGATACACGCCGCCCACGTG
  • 3′ sequencing primer ATCGTCGACCACTGTGCTGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

There's a G525R mutation in ER. Please see Nucleic Acids Research, 1995, Vol. 23, 1686-1690 for reference regarding this mutation.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LZRS-Flag_EZH2_ER was a gift from Howard Chang (Addgene plasmid # 26111 ; http://n2t.net/addgene:26111 ; RRID:Addgene_26111)
  • For your References section:

    Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Gupta RA, Shah N, Wang KC, Kim J, Horlings HM, Wong DJ, Tsai MC, Hung T, Argani P, Rinn JL, Wang Y, Brzoska P, Kong B, Li R, West RB, van de Vijver MJ, Sukumar S, Chang HY. Nature. 2010 Apr 15. 464(7291):1071-6. 10.1038/nature08975 PubMed 20393566