Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #26111)


Item Catalog # Description Quantity Price (USD)
Plasmid 26111 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 11100
  • Vector type
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    EZH2 (a.k.a. ENX-1, ENX1, EZH2b, KMT6, KMT6A, WVS, WVS2)
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • ER (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ cloning site attR (destroyed during cloning)
  • 3′ cloning site attR (destroyed during cloning)
  • 5′ sequencing primer TGGATACACGCCGCCCACGTG
  • 3′ sequencing primer ATCGTCGACCACTGTGCTGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

There's a G525R mutation in ER. Please see Nucleic Acids Research, 1995, Vol. 23, 1686-1690 for reference regarding this mutation.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LZRS-Flag_EZH2_ER was a gift from Howard Chang (Addgene plasmid # 26111 ; ; RRID:Addgene_26111)
  • For your References section:

    Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Gupta RA, Shah N, Wang KC, Kim J, Horlings HM, Wong DJ, Tsai MC, Hung T, Argani P, Rinn JL, Wang Y, Brzoska P, Kong B, Li R, West RB, van de Vijver MJ, Sukumar S, Chang HY. Nature. 2010 Apr 15. 464(7291):1071-6. 10.1038/nature08975 PubMed 20393566