PGL3-NOXA-N2
(Plasmid
#26113)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 26113 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL3
-
Backbone manufacturerpromega
- Backbone size w/o insert (bp) 5000
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNOXA N2
-
Alt nameNOXA promoter
-
Alt namePMAIP1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)212
-
GenBank IDNM_021127
-
Entrez GenePMAIP1 (a.k.a. APR, NOXA)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer CGAGCTCTCGCGCTCAGCGGGGTACTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PGL3-NOXA-N2 was a gift from Yihong Ye (Addgene plasmid # 26113 ; http://n2t.net/addgene:26113 ; RRID:Addgene_26113) -
For your References section:
ERAD inhibitors integrate ER stress with an epigenetic mechanism to activate BH3-only protein NOXA in cancer cells. Wang Q, Mora-Jensen H, Weniger MA, Perez-Galan P, Wolford C, Hai T, Ron D, Chen W, Trenkle W, Wiestner A, Ye Y. Proc Natl Acad Sci U S A. 2009 Feb 17. 106(7):2200-5. 10.1073/pnas.0807611106 PubMed 19164757