Skip to main content
Addgene

pMV306G13+FFluc
(Plasmid #26157)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 26157 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMV306
  • Backbone size w/o insert (bp) 3995
  • Vector type
    Mycobacteria integrating vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    G13 promoter + Firefly luciferase
  • Alt name
    FFluc
  • Alt name
    Luc
  • Species
    Mycobacterium marinum + Photinus pyralis
  • Insert Size (bp)
    2155
  • Mutation
    Codon optimized for Mycobacterium tuberculosis. Lacks the last 3 aa

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer gatcgccactagcgccgcgg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Firefly luciferase gene codon optimised for Mycobacterium was cloned from pJ246:17659 obtained from Jeff Cirillo (Texas A&M) and Kevin Francis (Caliper Life Sciences)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMV306G13+FFluc was a gift from Brian Robertson & Siouxsie Wiles (Addgene plasmid # 26157 ; http://n2t.net/addgene:26157 ; RRID:Addgene_26157)
  • For your References section:

    Optimisation of bioluminescent reporters for use with mycobacteria. Andreu N, Zelmer A, Fletcher T, Elkington PT, Ward TH, Ripoll J, Parish T, Bancroft GJ, Schaible U, Robertson BD, Wiles S. PLoS One. 2010 May 24;5(5):e10777. 10.1371/journal.pone.0010777 PubMed 20520722