pMV306hsp+FFlucWT
(Plasmid
#26158)
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26158 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMV306hsp
- Backbone size w/o insert (bp) 4373
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFirefly luciferase
-
Alt nameFFluc
-
Alt nameLuc
-
SpeciesPhotinus pyralis
-
Insert Size (bp)1666
-
MutationLacks the last 3 aa.
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer agaataacgttggcactcgc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFirefly luciferase gene cloned from pGL2-Basic (Promega)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMV306hsp+FFlucWT was a gift from Brian Robertson & Siouxsie Wiles (Addgene plasmid # 26158 ; http://n2t.net/addgene:26158 ; RRID:Addgene_26158) -
For your References section:
Optimisation of bioluminescent reporters for use with mycobacteria. Andreu N, Zelmer A, Fletcher T, Elkington PT, Ward TH, Ripoll J, Parish T, Bancroft GJ, Schaible U, Robertson BD, Wiles S. PLoS One. 2010 May 24;5(5):e10777. 10.1371/journal.pone.0010777 PubMed 20520722