Skip to main content

pJFRC-MUH
(Plasmid #26213)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 26213 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBDP
  • Backbone size (bp) 7831
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer hsp70 F: GAGCGCCGGAGTATAAATAGAG
  • 3′ sequencing primer SV40 R: CCATTCATCAGTTCCATAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJFRC-MUH was a gift from Gerald Rubin (Addgene plasmid # 26213 ; http://n2t.net/addgene:26213 ; RRID:Addgene_26213)
  • For your References section:

    Refinement of tools for targeted gene expression in Drosophila. Pfeiffer BD, Ngo TT, Hibbard KL, Murphy C, Jenett A, Truman JW, Rubin GM. Genetics. 2010 Oct;186(2):735-55. doi: 10.1534/genetics.110.119917. Epub 2010 Aug 9. 10.1534/genetics.110.119917 PubMed 20697123