pCAG-BxB1
(Plasmid #262516)

• Purpose: Serine recombinase for site-specific DNA integration between attP and attB landing sites.
• Depositing Lab: Prashant Mali
• Depositing Organization: University of California, San Diego (UCSD)
  Located in the United States of America
• Publication: Nourreddine et al Nat Biotechnol. 2026 Jul 1. doi: 10.1038/s41587-026-03199-w.

Backbone

• Vector backbone: pUC
• Total vector size (bp): 6378
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Bxb1
• Species: Mycobacteriophage
• Promoter: CAG
• Tag / Fusion Protein:
  • SV40 NLS, HA (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATAATACGACTCACTATAGGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Mammalian expression plasmid encoding wild-type Bxb1 integrase (serine recombinase from Mycobacteriophage Bxb1, UniProt Q9B086) with an N-terminal SV40 nuclear localization signal (NLS) and HA epitope tag. Expression is driven by the CAG promoter with a BGH poly(A) signal. A T7 promoter upstream of the CDS allows in vitro transcription. This plasmid serves as the integrase helper for Bxb1-mediated recombination between attP and attB sites — use with the AAVS1 BxB1 landing pad for site-specific cassette exchange at the AAVS1 safe harbor locus.