-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26273 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSicoR
- Backbone size w/o insert (bp) 7560
-
Vector typeMammalian Expression, Lentiviral, RNAi, Cre/Lox
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namep53 shRNA
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)55
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (destroyed during cloning)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer TGCAGGGGAAAGAATAGTAGAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The shRNA is directed against the mouse p53 sequence 5'-GTACTCTCCTCCCCTCAAT-3'.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PSICORhp-mp53 was a gift from Rudolf Jaenisch (Addgene plasmid # 26273 ; http://n2t.net/addgene:26273 ; RRID:Addgene_26273) -
For your References section:
Direct cell reprogramming is a stochastic process amenable to acceleration. Hanna J, Saha K, Pando B, van Zon J, Lengner CJ, Creyghton MP, van Oudenaarden A, Jaenisch R. Nature. 2009 Dec 3. 462(7273):595-601. 10.1038/nature08592 PubMed 19898493