Skip to main content

pBRPyCAG-fmKlf4-DsRed-Ip
(Plasmid #26274)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 26274 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBRYCAG-floxStop dsRED-IresPuro
  • Backbone size w/o insert (bp) 8050
  • Vector type
    Mammalian Expression, Cre/Lox
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Klf4
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1450
  • Entrez Gene
    Klf4 (a.k.a. EZF, Gklf, Zie)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer gtccccttctccctctccagcctcgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBRPyCAG-fmKlf4-DsRed-Ip was a gift from Rudolf Jaenisch (Addgene plasmid # 26274 ; http://n2t.net/addgene:26274 ; RRID:Addgene_26274)
  • For your References section:

    Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs. Hanna J, Cheng AW, Saha K, Kim J, Lengner CJ, Soldner F, Cassady JP, Muffat J, Carey BW, Jaenisch R. Proc Natl Acad Sci U S A. 2010 May 18. 107(20):9222-7. 10.1073/pnas.1004584107 PubMed 20442331