Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pDREV-0
(Plasmid #26750)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 26750 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pL1L2_gt0
  • Backbone manufacturer
    B. Rosen and W.C.Skarnes, unpublished
  • Backbone size w/o insert (bp) 4500
  • Vector type
    Mammalian Expression, Cre/Lox ; FLP/FRT; DRE/Rox
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Nourseothricin (clonNat), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    H2B-Venus CDS
  • Alt name
    HIST1H2BB, H2B.1, H2B/f, H2BFF, MGC119804
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1101
  • GenBank ID
    NM_021058
  • Entrez Gene
    H2BC3 (a.k.a. H2B.1, H2B/f, H2BFF, HIST1H2BB)
  • Tag / Fusion Protein
    • Venus (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BlgII (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer FCHK2 sequence: GTATCTGCAACCTCAAGCTAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    PGK-Puro cassette from Addgene plasmid 11349

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The pDREV plasmid series encode a 5' FRT site and a 3' loxP site for re-engineering of the IKMC knock-out first alleles by dual RMCE (dRMCE) as described in Osterwalder et al. "Dual RMCE for efficient re-engineering of mouse mutant alleles" Nature Methods (2010) DOI 10.1038/nmeth.1521

Protocol for using these plasmids can be found here: http://www.nature.com/protocolexchange/protocols/1906

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDREV-0 was a gift from Rolf Zeller (Addgene plasmid # 26750 ; http://n2t.net/addgene:26750 ; RRID:Addgene_26750)
  • For your References section:

    Dual RMCE for efficient re-engineering of mouse mutant alleles. Osterwalder M, Galli A, Rosen B, Skarnes WC, Zeller R, Lopez-Rios J.. Nat Methods. 2010 Oct 17 10.1038/nmeth.1521 PubMed 20953177