pDREV-2
(Plasmid
#26752)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26752 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepL1L2_gt2
-
Backbone manufacturerB. Rosen and W.C.Skarnes, unpublished
- Backbone size w/o insert (bp) 4500
-
Vector typeMammalian Expression, Cre/Lox ; FLP/FRT; DRE/Rox
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Nourseothricin (clonNat), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH2B-Venus CDS
-
Alt nameHIST1H2BB, H2B.1, H2B/f, H2BFF, MGC119804
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1101
-
GenBank IDNM_021058
-
Entrez GeneH2BC3 (a.k.a. H2B.1, H2B/f, H2BFF, HIST1H2BB)
-
Tag
/ Fusion Protein
- Venus (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BlgII (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer FCHK2 sequence: GTATCTGCAACCTCAAGCTAGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPGK-Puro cassette from Addgene plasmid 11349
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The pDREV plasmid series encode a 5' FRT site and a 3' loxP site for re-engineering of the IKMC knock-out first alleles by dual RMCE (dRMCE) as described in Osterwalder et al. "Dual RMCE for efficient re-engineering of mouse mutant alleles" Nature Methods (2010) DOI 10.1038/nmeth.1521
Protocol for using these plasmids can be found here: http://www.nature.com/protocolexchange/protocols/1906
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDREV-2 was a gift from Rolf Zeller (Addgene plasmid # 26752 ; http://n2t.net/addgene:26752 ; RRID:Addgene_26752) -
For your References section:
Dual RMCE for efficient re-engineering of mouse mutant alleles. Osterwalder M, Galli A, Rosen B, Skarnes WC, Zeller R, Lopez-Rios J.. Nat Methods. 2010 Oct 17 10.1038/nmeth.1521 PubMed 20953177