pEnt L1L3 EF1a-tTA-2
(Plasmid #26803)

• Depositing Lab: Edward Hsiao
• Depositing Organization: J. David Gladstone Institutes
  Located in United States of America
• Publication: Hsiao et al Stem Cell Res Ther. 2011 Mar 4. 2(2):11.
• Citations: 1 Article

Backbone

• Vector backbone: pEntr2B
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4200
• Vector type: Mammalian Expression, Gateway Cloning

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Elongation Factor 1 alpha promoter and tTA transgene
• Alt name: TetOff
• Insert Size (bp): 1700

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TCTACAAACTCTTCCTGTTAGT
• 3′ sequencing primer: AGAGATTTTGAGACACGGGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Contains Gateway L1L3 sites and EF1α promoter driving tTA. Contains insulator sequence.

Plasmid was constructed as follows: The pEntr2B entry vector was digested with PstI and XhoI to remove the attL2 site. Oligonucleotides containing SalI-XhoI-Bsu36I-NdeI-PacI-EcoRI-NotI flanking the attL3 sequence on the 5' side and PstI on the 3' side were ligated in to create an intermediate plasmid carrying attL1 and attL3 sites (from pDest R4-R3. A LoxP sequence was introduced at the XhoI site, and the 500-bp chicken β-globin (CBG) HS4 insulator sequence was introduced at the Bsu36I/NdeI sites. The tTA and pA sequences were subsequently cloned into the EcoRI/NotI sites by PCR cloning from pUHG15-1. The EF1α promoter from pORF9 was cloned into the PacI to generate the final entry vector pEntL1L3 EF1α-tTA-2.

DNA (Catalog # 26803-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 26803-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.