Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pEnt L1L3 EF1a-tTA-2
(Plasmid #26803)


Item Catalog # Description Quantity Price (USD)
Plasmid 26803 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4200
  • Vector type
    Mammalian Expression ; Gateway Entry vector

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    Elongation Factor 1 alpha promoter and tTA transgene
  • Alt name
  • Insert Size (bp)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCTACAAACTCTTCCTGTTAGT
  • 3′ sequencing primer AGAGATTTTGAGACACGGGC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Contains Gateway L1L3 sites and EF1α promoter driving tTA. Contains insulator sequence.

Plasmid was constructed as follows: The pEntr2B entry vector was digested with PstI and XhoI to remove the attL2 site. Oligonucleotides containing SalI-XhoI-Bsu36I-NdeI-PacI-EcoRI-NotI flanking the attL3 sequence on the 5' side and PstI on the 3' side were ligated in to create an intermediate plasmid carrying attL1 and attL3 sites (from pDest R4-R3. A LoxP sequence was introduced at the XhoI site, and the 500-bp chicken β-globin (CBG) HS4 insulator sequence was introduced at the Bsu36I/NdeI sites. The tTA and pA sequences were subsequently cloned into the EcoRI/NotI sites by PCR cloning from pUHG15-1. The EF1α promoter from pORF9 was cloned into the PacI to generate the final entry vector pEntL1L3 EF1α-tTA-2.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEnt L1L3 EF1a-tTA-2 was a gift from Edward Hsiao (Addgene plasmid # 26803 ; ; RRID:Addgene_26803)
  • For your References section:

    Constitutive Gs activation using a single-construct tetracycline-inducible expression system in embryonic stem cells and mice. Hsiao EC, Nguyen TD, Ng JK, Scott MJ, Chang WC, Zahed H, Conklin BR. Stem Cell Res Ther. 2011 Mar 4. 2(2):11. 10.1186/scrt52 PubMed 21375737