Skip to main content

pCBFRE-(mt)-luc
(Plasmid #26896)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 26896 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Unknown
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CBFRE
  • Alt name
    CBF1-responsive element
  • Insert Size (bp)
    144
  • Mutation
    Mutated CBF1 sites (see note)
  • Tag / Fusion Protein
    • Luciferase (C terminal on backbone)

Cloning Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

CBFRE: four (mutated) CBF1-binding elements from EBV (see Hsieh MCB 1996, 16:952) and the basal simian virus 40 (SV40) promoter upstream of Luciferase. The sequence of the mutated CBF1 binding element is (GATCTGGTGTAAA CACGGGCTTGGAAAAAATTTATG).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCBFRE-(mt)-luc was a gift from Nicholas Gaiano (Addgene plasmid # 26896 ; http://n2t.net/addgene:26896 ; RRID:Addgene_26896)
  • For your References section:

    Notch signaling activation in human embryonic stem cells is required for embryonic, but not trophoblastic, lineage commitment. Yu X, Zou J, Ye Z, Hammond H, Chen G, Tokunaga A, Mali P, Li YM, Civin C, Gaiano N, Cheng L. Cell Stem Cell. 2008 May 8. 2(5):461-71. 10.1016/j.stem.2008.03.001 PubMed 18462696