-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26896 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneUnknown
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCBFRE
-
Alt nameCBF1-responsive element
-
Insert Size (bp)144
-
MutationMutated CBF1 sites (see note)
-
Tag
/ Fusion Protein
- Luciferase (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer n/a
- 3′ sequencing primer Luc_N_Rev (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CBFRE: four (mutated) CBF1-binding elements from EBV (see Hsieh MCB 1996, 16:952) and the basal simian virus 40 (SV40) promoter upstream of Luciferase. The sequence of the mutated CBF1 binding element is (GATCTGGTGTAAA CACGGGCTTGGAAAAAATTTATG).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCBFRE-(mt)-luc was a gift from Nicholas Gaiano (Addgene plasmid # 26896 ; http://n2t.net/addgene:26896 ; RRID:Addgene_26896) -
For your References section:
Notch signaling activation in human embryonic stem cells is required for embryonic, but not trophoblastic, lineage commitment. Yu X, Zou J, Ye Z, Hammond H, Chen G, Tokunaga A, Mali P, Li YM, Civin C, Gaiano N, Cheng L. Cell Stem Cell. 2008 May 8. 2(5):461-71. 10.1016/j.stem.2008.03.001 PubMed 18462696