Skip to main content
Addgene

Psicheck2 COLIA1 full length 3'UTR
(Plasmid #26993)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 26993 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    psiCHECK-2
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 6300
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    COL1A1 Full length 3' UTR
  • Alt name
    COL1A1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1400
  • Entrez Gene
    COL1A1 (a.k.a. CAFYD, EDSARTH1, EDSC, OI1, OI2, OI3, OI4)
  • Tag / Fusion Protein
    • Renilla Luciferase (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer Rluc-F
  • 3′ sequencing primer psiCHECK2-R (CGAGGTCCGAAGACTCATTT)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A single base pair mutation is present in the UTR insert
that does not alter the miR-335 complementary motif.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Psicheck2 COLIA1 full length 3'UTR was a gift from Joan Massague (Addgene plasmid # 26993 ; http://n2t.net/addgene:26993 ; RRID:Addgene_26993)
  • For your References section:

    Endogenous human microRNAs that suppress breast cancer metastasis. Tavazoie SF, Alarcon C, Oskarsson T, Padua D, Wang Q, Bos PD, Gerald WL, Massague J. Nature. 2008 Jan 10. 451(7175):147-52. 10.1038/nature06487 PubMed 18185580