Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pEnt R3L2 TetO(fl)-3
(Plasmid #27107)


Item Catalog # Description Quantity Price (USD)
Plasmid 27107 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 2300
  • Vector type
    Entry Vector

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    TetO promoter
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer TCTACAAACTCTTCCTGTTAGT
  • 3′ sequencing primer AGAGATTTTGAGACACGGGC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Contains Gateway R3L2 sites and full-length (7 repeat) TetO. SbfI, FseI, AvrII, and SalI sites can be used to insert gene of interest, driven by TetO. Does not contain insulator sequence.

This plasmid was constructed as follows: The pEntr2B entry vector was digested with AflII and XhoI to remove the attL1 and ccdb genes. Oligos
containing the attR3 site flanked by AflII on the 5' end and a polylinker (NotI-PacI-Bsu36I-NdeI-XhoI) on the 3' end were ligated to generate the empty pEntR3L2-MCS intermediate (Addgene plasmid number 26799). Using PCR cloning, the TetO-beta globin
intron sequence from pTetO (pUHD10.3) was cloned into the NotI/PacI sites in the reverse orientation,
and a 3' SbfI site was introduced. The pA sequence from pDest27 (Invitrogen) was then cloned into the
NotI/SbfI sites, again in reverse orientation. A LoxP site was introduced into the NdeI/XhoI sites, allowing full
excision of the targeted construct when used together with the LoxP site in the pEntl1L3 vector.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEnt R3L2 TetO(fl)-3 was a gift from Edward Hsiao (Addgene plasmid # 27107 ; ; RRID:Addgene_27107)
  • For your References section:

    Constitutive Gs activation using a single-construct tetracycline-inducible expression system in embryonic stem cells and mice. Hsiao EC, Nguyen TD, Ng JK, Scott MJ, Chang WC, Zahed H, Conklin BR. Stem Cell Res Ther. 2011 Mar 4. 2(2):11. 10.1186/scrt52 PubMed 21375737