pEnt R3L2 TetO(fl)-3
(Plasmid #27107)

• Depositing Lab: Edward Hsiao
• Publication: Hsiao et al Stem Cell Res Ther. 2011 Mar 4. 2(2):11.

Backbone

• Vector backbone: pEntr2B
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 2300
• Vector type: Entry Vector

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TetO promoter
• Insert Size (bp): 1300

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: TCTACAAACTCTTCCTGTTAGT
• 3′ sequencing primer: AGAGATTTTGAGACACGGGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Contains Gateway R3L2 sites and full-length (7 repeat) TetO. SbfI, FseI, AvrII, and SalI sites can be used to insert gene of interest, driven by TetO. Does not contain insulator sequence.

This plasmid was constructed as follows: The pEntr2B entry vector was digested with AflII and XhoI to remove the attL1 and ccdb genes. Oligos
containing the attR3 site flanked by AflII on the 5' end and a polylinker (NotI-PacI-Bsu36I-NdeI-XhoI) on the 3' end were ligated to generate the empty pEntR3L2-MCS intermediate (Addgene plasmid number 26799). Using PCR cloning, the TetO-beta globin
intron sequence from pTetO (pUHD10.3) was cloned into the NotI/PacI sites in the reverse orientation,
and a 3' SbfI site was introduced. The pA sequence from pDest27 (Invitrogen) was then cloned into the
NotI/SbfI sites, again in reverse orientation. A LoxP site was introduced into the NdeI/XhoI sites, allowing full
excision of the targeted construct when used together with the LoxP site in the pEntl1L3 vector.