-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 27137 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepHR'
- Backbone size w/o insert (bp) 9000
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCherry and ZAP70 (residues 1-259)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1572
-
Entrez GeneZAP70 (a.k.a. ADMIO2, IMD48, SRK, STCD, STD, TZK, ZAP-70)
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GCTTCCCGAGCTCTATAAAAGAGC
- 3′ sequencing primer CCAGAGGTTGATTATCGATAAGC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-mCherry-tSH2(ZAP70) was a gift from Ron Vale (Addgene plasmid # 27137 ; http://n2t.net/addgene:27137 ; RRID:Addgene_27137) -
For your References section:
Imaging T-cell receptor activation reveals accumulation of tyrosine-phosphorylated CD3{zeta} in the endosomal compartment. Yudushkin IA, Vale RD. Proc Natl Acad Sci U S A. 2010 Dec 21;107(51):22128-33. 10.1073/pnas.1016388108 PubMed 21135224