This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #27134)

Item Catalog # Description Quantity Price (USD)
Plasmid 27134 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

  • Vector backbone
  • Backbone size w/o insert (bp) 9000
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number

  • Gene/Insert name
    CD3zeta, eGFP, mCherry and ZAP70 (residues 1-259)
  • Alt name
    CD3zeta ITAMs phosphorylation reporter
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
  • Tags / Fusion Proteins
    • eGFP
    • mCherry

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GCTTCCCGAGCTCTATAAAAGAGC
  • 3′ sequencing primer CCAGAGGTTGATTATCGATAAGC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-ZIP(WT) was a gift from Ron Vale (Addgene plasmid # 27134)
  • For your References section:

    Imaging T-cell receptor activation reveals accumulation of tyrosine-phosphorylated CD3{zeta} in the endosomal compartment. Yudushkin IA, Vale RD.. Proc Natl Acad Sci U S A. 2010 Dec 21;107(51):22128-33. 10.1073/pnas.1016388108 PubMed 21135224