Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #89347)


Item Catalog # Description Quantity Price (USD)
Plasmid 89347 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    Jurkat TCRalpha/beta alleles and CD3e and CD3z
  • Species
    H. sapiens (human)
  • Promoter SFFV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer SFFV for (GCTTCCCGAGCTCTATAAAAGAGC)
  • 3′ sequencing primer WPRE rev (CCAGAGGTTGATTATCGATAAGC)
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TCRalpha_E2A_SP-SNAPf-TCRbeta_P2A_CD3e_P2A_CD3zeta was a gift from Ron Vale (Addgene plasmid # 89347 ; ; RRID:Addgene_89347)
  • For your References section:

    A DNA-Based T Cell Receptor Reveals a Role for Receptor Clustering in Ligand Discrimination. Taylor MJ, Husain K, Gartner ZJ, Mayor S, Vale RD. Cell. 2017 Mar 23;169(1):108-119.e20. doi: 10.1016/j.cell.2017.03.006. 10.1016/j.cell.2017.03.006 PubMed 28340336