pCLX-UBI-Tred
(Plasmid #27246)

• Depositing Lab: Patrick Salmon
• Publication: Bocchi et al Nat Commun. 2017 Oct 27;8(1):1158. doi: 10.1038/s41467-017-01046-w.

Backbone

• Vector backbone: pCLX
• Backbone size w/o insert (bp): 7932
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Growth instructions: Top10 or HB101
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TurboRFP
• Species: Entacmaea
• Insert Size (bp): 693

Cloning Information

• Cloning method: Gateway Cloning
• 5′ cloning site: attR4 (destroyed during cloning)
• 3′ cloning site: attR2 (destroyed during cloning)
• 5′ sequencing primer: ctagtaaagcttctgcaggt

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Evrogen
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry