Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAMPK alpha1 full length
(Plasmid #27297)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 27297 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1/Hygro
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5600
  • Total vector size (bp) 7300
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AMPK alpha1
  • Alt name
    AMP activated protein kinase
  • Alt name
    Prkaa1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1700
  • Entrez Gene
    Prkaa1 (a.k.a. AI194361, AI450832, AL024255, AMPK, AMPKalpha1, C130083N04Rik)
  • Tag / Fusion Protein
    • his (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Peter Leland Dept. of Biochemistry Univ of Wisconsin, Madison 433 Babcock Dr. Madison, WI 53704
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAMPK alpha1 full length was a gift from Morris Birnbaum (Addgene plasmid # 27297 ; http://n2t.net/addgene:27297 ; RRID:Addgene_27297)