Skip to main content
Addgene

gGamma Venus
(Plasmid #27811)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 27811 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP C1
  • Backbone size w/o insert (bp) 3984
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mVenus C1-gGamma
  • Alt name
    Venus GGamma
  • Alt name
    G-protein subunit γ2
  • Insert Size (bp)
    720

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe 1 (not destroyed)
  • 3′ cloning site Bam HI (not destroyed)
  • 5′ sequencing primer CCAAAATCAACGGGACTTTCC
  • 3′ sequencing primer CAGGTTCAGGGGGAGGTGTGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    gGamma Venus was a gift from Steven Vogel (Addgene plasmid # 27811 ; http://n2t.net/addgene:27811 ; RRID:Addgene_27811)
  • For your References section:

    Quantitative multiphoton spectral imaging and its use for measuring resonance energy transfer. Thaler C, Koushik SV, Blank PS, Vogel SS. Biophys J. 2005 Oct . 89(4):2736-49. 10.1529/biophysj.105.061853 PubMed 16040744