Skip to main content

AAV-CAG-hChR2_tdTomato
(Plasmid #28015)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 28015 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAV2/1
  • Backbone size w/o insert (bp) 4883
  • Vector type
    AAV ; adeno associate viral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl2
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    humanized ChR2-tdTomato
  • Alt name
    hChR2-tdTomato
  • Insert Size (bp)
    2363
  • Promoter CAG
  • Tag / Fusion Protein
    • tdTomato

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TCGGCTTCTGGCGTGTGACCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

with ITRs, this vector is easy to have recombination. Check with multiple restriction digestions.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-CAG-hChR2_tdTomato was a gift from Karel Svoboda (Addgene plasmid # 28015 ; http://n2t.net/addgene:28015 ; RRID:Addgene_28015)
  • For your References section:

    Long-Range Neuronal Circuits Underlying the Interaction between Sensory and Motor Cortex. Mao T, Kusefoglu D, Hooks BM, Huber D, Petreanu L, Svoboda K. Neuron. 2011 Oct 6;72(1):111-23. 10.1016/j.neuron.2011.07.029 PubMed 21982373