-
PurposeExpresses humanized ChR2 fused to tdTomato for optogenetic activation
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 28015 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV2/1
- Backbone size w/o insert (bp) 4883
-
Vector typeAAV ; adeno associate viral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl2
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namehumanized ChR2-tdTomato
-
Alt namehChR2-tdTomato
-
Insert Size (bp)2363
- Promoter CAG
-
Tag
/ Fusion Protein
- tdTomato
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TCGGCTTCTGGCGTGTGACCGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
with ITRs, this vector is easy to have recombination. Check with multiple restriction digestions.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-CAG-hChR2_tdTomato was a gift from Karel Svoboda (Addgene plasmid # 28015 ; http://n2t.net/addgene:28015 ; RRID:Addgene_28015) -
For your References section:
Long-Range Neuronal Circuits Underlying the Interaction between Sensory and Motor Cortex. Mao T, Kusefoglu D, Hooks BM, Huber D, Petreanu L, Svoboda K. Neuron. 2011 Oct 6;72(1):111-23. 10.1016/j.neuron.2011.07.029 PubMed 21982373