WDR61
(Plasmid
#28162)
-
PurposeBaculovirus expression for structure determination; may not be full ORF
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 28162 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepFBOH-MHL
-
Backbone manufacturerSGC
-
Vector typeBaculovirus expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameWD repeat domain 61
-
Alt namePDB: 3OW8
-
SpeciesH. sapiens (human)
-
Insert Size (bp)912
-
Entrez GeneSKIC8 (a.k.a. REC14, SKI8, WDR61)
- Promoter polyhedrin
-
Tag
/ Fusion Protein
- His tag with TEV cleavage (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ cloning site ligation-independent cloning (unknown if destroyed)
- 3′ cloning site ligation-independent cloning (unknown if destroyed)
- 5′ sequencing primer Polyhedrin forward, pFBOH-Fwd (CCGGATTATTCATACCGTCCCACC A) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PDB: 3OW8. http://www.thesgc.org/structures/3OW8/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
WDR61 was a gift from Cheryl Arrowsmith (Addgene plasmid # 28162 ; http://n2t.net/addgene:28162 ; RRID:Addgene_28162)