Skip to main content

pDTnLAPP2A frame 0
(Plasmid #28226)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 28226 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    CA1
  • Backbone size w/o insert (bp) 1672
  • Vector type
    Retroviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Hygrophosphotransferase-P2A-Enhanced Green Fluorescent Protein
  • Alt name
    Hygro
  • Alt name
    EGFP
  • Alt name
    nLAP
  • Species
    Aequorea victoria, E. coli
  • Insert Size (bp)
    3060
  • Tags / Fusion Proteins
    • EGFP (C terminal on insert)
    • nLAP-tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ATGCAACTGCAAGAGGGTTT
  • 3′ sequencing primer TGCACCCAACTGATCTTCAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Francis A. Stewart, Dresden, Germany
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Poser et al., Nature Meth. 5, (2008), 409-415

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDTnLAPP2A frame 0 was a gift from Harald von Melchner (Addgene plasmid # 28226 ; http://n2t.net/addgene:28226 ; RRID:Addgene_28226)
  • For your References section:

    Resources for proteomics in mouse embryonic stem cells. Schnutgen F, Ehrmann F, Poser I, Hubner NC, Hansen J, Floss T, Devries I, Wurst W, Hyman A, Mann M, von Melchner H. Nat Methods. 2011 Feb . 8(2):103-4. 10.1038/nmeth0211-103 PubMed 21278719