pDTnLAPP2A frame 0
(Plasmid
#28226)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 28226 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneCA1
- Backbone size w/o insert (bp) 1672
-
Vector typeRetroviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHygrophosphotransferase-P2A-Enhanced Green Fluorescent Protein
-
Alt nameHygro
-
Alt nameEGFP
-
Alt namenLAP
-
SpeciesAequorea victoria, E. coli
-
Insert Size (bp)3060
-
Tags
/ Fusion Proteins
- EGFP (C terminal on insert)
- nLAP-tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer ATGCAACTGCAAGAGGGTTT
- 3′ sequencing primer TGCACCCAACTGATCTTCAGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFrancis A. Stewart, Dresden, Germany
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Poser et al., Nature Meth. 5, (2008), 409-415
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDTnLAPP2A frame 0 was a gift from Harald von Melchner (Addgene plasmid # 28226 ; http://n2t.net/addgene:28226 ; RRID:Addgene_28226) -
For your References section:
Resources for proteomics in mouse embryonic stem cells. Schnutgen F, Ehrmann F, Poser I, Hubner NC, Hansen J, Floss T, Devries I, Wurst W, Hyman A, Mann M, von Melchner H. Nat Methods. 2011 Feb . 8(2):103-4. 10.1038/nmeth0211-103 PubMed 21278719