Skip to main content

RCIscript-GoldyTALEN
(Plasmid #38142)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 38142 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBSK
  • Backbone size w/o insert (bp) 2900
  • Total vector size (bp) 4651
  • Vector type
    mRNA transcription vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GoldyTALEN
  • Alt name
    TALEN
  • Species
    Synthetic
  • Insert Size (bp)
    1800
  • Mutation
    Truncate at N and C terminous
  • Promoter T3
  • Tags / Fusion Proteins
    • FokI homodimer (C terminal on insert)
    • AcV5 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp31 (destroyed during cloning)
  • 3′ cloning site Esp31 (destroyed during cloning)
  • 5′ sequencing primer CGTGACCGCAATGGAGGC
  • 3′ sequencing primer CACTGCATCCATGGCAGG
  • (Common Sequencing Primers)

Resource Information

  • Addgene Notes
  • A portion of this plasmid was derived from a plasmid made by
    It is a deriviative of a plasmid (pTAL-Leu) in the TALEN kit supplied by Dan Voytas.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that this plasmid can be prone to recombination in bacteria. We recommend storing and propagating the construct in Stbl3 cells and screen 4-6 colonies by sequencing with TAL_F1 (ttggcgtcggcaaacagtgg) primer.

The F1 origin feature in the full plasmid sequence is in reverse compliment orientation. Please view Addgene's quality control sequence for the most accurate information. The flipped orientation does not affect the SacI site necessary to linearize the plasmid.

For further reference, this plasmid was also used in the Bedell et al Nature 2012 publication (PMID 23000899).

For more information on Carlson TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#carlson

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RCIscript-GoldyTALEN was a gift from Daniel Carlson & Stephen Ekker (Addgene plasmid # 38142 ; http://n2t.net/addgene:38142 ; RRID:Addgene_38142)
  • For your References section:

    Efficient TALEN-mediated gene knockout in livestock. Carlson DF, Tan W, Lillico SG, Stverakova D, Proudfoot C, Christian M, Voytas DF, Long CR, Whitelaw CB, Fahrenkrug SC. Proc Natl Acad Sci U S A. 2012 Oct 1. 10.1073/pnas.1211446109 PubMed 23027955