Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pASK/3xMBT
(Plasmid #28234)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 28234 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pASK-IBA43plus
  • Backbone manufacturer
    IBA
  • Backbone size w/o insert (bp) 3286
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    l(3)mbt-like 1 (Drosophila)
  • Alt name
    L3MBTL1
  • Alt name
    L3MBTL
  • Alt name
    H-L(3)MBT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1065
  • Mutation
    Truncation expressing only aa 252-606 (MBT repeats).
  • GenBank ID
    NM_015478
  • Entrez Gene
    L3MBTL1 (a.k.a. H-L(3)MBT, L3MBTL, ZC2HC3, dJ138B7.3)
  • Tag / Fusion Protein
    • His (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GAGTTATTTTACCACTCCCT
  • 3′ sequencing primer CGCAGTAGCGGTAAACG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pASK/3xMBT was a gift from Danny Reinberg (Addgene plasmid # 28234 ; http://n2t.net/addgene:28234 ; RRID:Addgene_28234)
  • For your References section:

    L3MBTL1, a histone-methylation-dependent chromatin lock. Trojer P, Li G, Sims RJ, Vaquero A, Kalakonda N, Boccuni P, Lee D, Erdjument-Bromage H, Tempst P, Nimer SD, Wang YH, Reinberg D. Cell. 2007 Jun 1. 129(5):915-28. 10.1016/j.cell.2007.03.048 PubMed 17540172