pASK/3xMBT
(Plasmid
#28234)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 28234 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepASK-IBA43plus
-
Backbone manufacturerIBA
- Backbone size w/o insert (bp) 3286
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namel(3)mbt-like 1 (Drosophila)
-
Alt nameL3MBTL1
-
Alt nameL3MBTL
-
Alt nameH-L(3)MBT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1065
-
MutationTruncation expressing only aa 252-606 (MBT repeats).
-
GenBank IDNM_015478
-
Entrez GeneL3MBTL1 (a.k.a. H-L(3)MBT, L3MBTL, ZC2HC3, dJ138B7.3)
-
Tag
/ Fusion Protein
- His (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GAGTTATTTTACCACTCCCT
- 3′ sequencing primer CGCAGTAGCGGTAAACG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pASK/3xMBT was a gift from Danny Reinberg (Addgene plasmid # 28234 ; http://n2t.net/addgene:28234 ; RRID:Addgene_28234) -
For your References section:
L3MBTL1, a histone-methylation-dependent chromatin lock. Trojer P, Li G, Sims RJ, Vaquero A, Kalakonda N, Boccuni P, Lee D, Erdjument-Bromage H, Tempst P, Nimer SD, Wang YH, Reinberg D. Cell. 2007 Jun 1. 129(5):915-28. 10.1016/j.cell.2007.03.048 PubMed 17540172