Skip to main content
Holiday Schedule: Addgene will be closed December 23 - January 2. Order processing and shipping will resume on January 3, 2023. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #28307)


Item Catalog # Description Quantity Price (USD)
Plasmid 28307 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Scott Sternson
  • Backbone size w/o insert (bp) 5769
  • Vector type
    Mammalian Expression, AAV, Cre/Lox ; Adeno-associated virus

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Use recombinase-free E. coli (Stbl3, XL-10, Sure2, grow at 30C
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
  • Alt name
    archaerhodopsin TP009
  • Alt name
  • Species
    H. strain TP009
  • Insert Size (bp)
  • Mutation
  • Promoter CAG
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gctctagagcctctgctaacc
  • 3′ sequencing primer gcagcgtatccacatagcg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.

Depositor Comments


How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-FLEX-ArchT-GFP was a gift from Edward Boyden (Addgene plasmid # 28307 ; ; RRID:Addgene_28307)
  • For your References section:

    A high-light sensitivity optical neural silencer: development and application to optogenetic control of non-human primate cortex. Han X, Chow BY, Zhou H, Klapoetke NC, Chuong A, Rajimehr R, Yang A, Baratta MV, Winkle J, Desimone R, Boyden ES. Front Syst Neurosci. 2011;5:18. Epub 2011 Apr 13. 10.3389/fnsys.2011.00018 PubMed 21811444