psiCHECK2-p27Kip1 3'UTR
(Plasmid
#29476)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 29476 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepsiCHECK2 (Promega)
- Backbone size w/o insert (bp) 6273
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namep27 Kip1 3'UTR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1344
-
Entrez GeneCDKN1B (a.k.a. CDKN4, KIP1, MEN1B, MEN4, P27KIP1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer GTCCGCAACTACAACGCCTACCTT
- 3′ sequencing primer AATGAGAGTGTTTCGTTCCTTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psiCHECK2-p27Kip1 3'UTR was a gift from Judy Lieberman (Addgene plasmid # 29476 ; http://n2t.net/addgene:29476 ; RRID:Addgene_29476) -
For your References section:
miR-24 Inhibits cell proliferation by targeting E2F2, MYC, and other cell-cycle genes via binding to "seedless" 3'UTR microRNA recognition elements. Lal A, Navarro F, Maher CA, Maliszewski LE, Yan N, O'Day E, Chowdhury D, Dykxhoorn DM, Tsai P, Hofmann O, Becker KG, Gorospe M, Hide W, Lieberman J. Mol Cell. 2009 Sep 11. 35(5):610-25. 10.1016/j.molcel.2009.08.020 PubMed 19748357