-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 29766 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneMSCV puro
- Backbone size w/o insert (bp) 6000
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namelet-7 sponge
-
Insert Size (bp)150
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site blunt (unknown if destroyed)
- 5′ sequencing primer pLXSN-5 (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The let-7 family sponge contains six bulged sites with alternating sequences AACUAUACAAGGACUACCUCA and AACUAUACAAUGACUACCUCA. The binding sites are for a consensus sequence of all mammalian let-7 miRNAs
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV puro let-7 sponge was a gift from Phil Sharp (Addgene plasmid # 29766 ; http://n2t.net/addgene:29766 ; RRID:Addgene_29766) -
For your References section:
Suppression of non-small cell lung tumor development by the let-7 microRNA family. Kumar MS, Erkeland SJ, Pester RE, Chen CY, Ebert MS, Sharp PA, Jacks T. Proc Natl Acad Sci U S A. 2008 Mar 11;105(10):3903-8. doi: 10.1073/pnas.0712321105 10.1073/pnas.0712321105 PubMed 18308936